Endpoint reference.

Authorization: Bearer $GC_API_KEY

{
  "order_id": "ord_01JZ8N8A4P2Y",
  "type": "wgs_3x",
  "type_label": "3x whole genome sequencing",
  "client_name": "Acme Health",
  "user_reference": "user_123",
  "status": "created",
  "status_label": "Order created",
  "activation_code": "ACT-7HD2-9QK4",
  "activation_url": "https://sample.bio/activate/ACT-7HD2-9QK4",
  "deliverables": ["genome_bundle"],
  "retention": "hosted_runtime",
  "price_cents": 29900,
  "shipping_fee_cents": 0,
  "total_cents": 29900,
  "currency": "usd",
  "estimated_completion_date": null,
  "shipment": null,
  "genome_id": null,
  "storage_expires_at": null,
  "created_at": "2026-05-21T10:20:05.000Z",
  "updated_at": "2026-05-21T10:20:05.000Z"
}

{
  "panel_result_id": "pan_9y2m1q",
  "panel_id": "nutrition_diet_response",
  "title": "Nutrition & Diet Response",
  "genome_id": "gen_test_nutrition_001",
  "interpretation_version": "2026.05.1",
  "summary": "Inherited tendencies in how this user processes foods and drinks, with high-to-moderate evidence. Suitable for an evidence summary card, not diagnosis or treatment.",
  "sections": [
    {
      "section_id": "food_drink_metabolism",
      "title": "Food & Drink Metabolism",
      "evidence_level": "high",
      "findings": [
        {
          "id": "rs4988235",
          "type": "variant",
          "title": "MCM6 rs4988235",
          "gene": "MCM6",
          "variant_id": "rs4988235",
          "result": { "genotype": "GA", "alleles": ["G", "A"] },
          "result_label": "One copy of G and one copy of A",
          "meaning": "The main lactase-persistence variant in European-ancestry populations; the persistence allele is associated with digesting dairy into adulthood. Separate persistence variants in African and Middle Eastern populations are not captured by this SNP, so a non-persistence call here does not rule out persistence in those ancestries.",
          "evidence_level": "high",
          "evidence": {
            "basis": "GWAS Catalog",
            "clinical_review": "Review food & drink metabolism context alongside labs, history, medications, and clinician oversight.",
            "validated_populations": ["European"]
          },
          "sequence_context": {
            "type": "reference_context_with_observed_variant",
            "available": true,
            "source": "wgs_vcf_plus_grch38_reference",
            "reference_genome": "GRCh38",
            "chromosome": "2",
            "position": 135851076,
            "window_bp": 41,
            "left_flank": "GAGTTCCTTTGAGGCCAGGG",
            "observed_variant": "G/A",
            "right_flank": "CTACATTATCTTATCTGTAT",
            "display_sequence": "GAGTTCCTTTGAGGCCAGGG[G/A]CTACATTATCTTATCTGTAT",
            "personalized_flanks": false
          }
        },
        {
          "id": "rs762551",
          "type": "variant",
          "title": "CYP1A2 rs762551",
          "gene": "CYP1A2",
          "variant_id": "rs762551",
          "result": { "genotype": "AC", "alleles": ["A", "C"] },
          "result_label": "One copy of A and one copy of C",
          "meaning": "Associated with CYP1A2 inducibility and caffeine-metabolism rate; the *1F allele links to higher inducible activity in some studies. Smoking and other inducers also strongly affect CYP1A2, so genotype is only part of the picture.",
          "evidence_level": "moderate",
          "evidence": {
            "basis": "PharmGKB, GWAS Catalog",
            "clinical_review": "Review food & drink metabolism context alongside labs, history, medications, and clinician oversight.",
            "validated_populations": ["broad"]
          }
        }
      ]
    },
    {
      "section_id": "diet_composition",
      "title": "Diet Composition Response",
      "evidence_level": "moderate",
      "findings": [
        {
          "id": "rs174537",
          "type": "variant",
          "title": "FADS1 rs174537",
          "gene": "FADS1",
          "variant_id": "rs174537",
          "result": { "genotype": "GT", "alleles": ["G", "T"] },
          "result_label": "One copy of G and one copy of T",
          "meaning": "FADS1 is associated with the efficiency of converting plant ALA into long-chain omega-3 (EPA/DHA); some versions are associated with lower conversion in studies. Diet decisions should weigh intake, labs, and clinician guidance, not genotype alone.",
          "evidence_level": "moderate",
          "evidence": {
            "basis": "GWAS Catalog, gnomAD",
            "clinical_review": "Review diet composition response context alongside labs, history, medications, and clinician oversight.",
            "validated_populations": ["broad"]
          }
        }
      ]
    }
  ],
  "citations": [
    {
      "source": "GWAS Catalog",
      "url": "https://www.ebi.ac.uk/gwas/",
      "accessed_at": "2026-05-20"
    },
    {
      "source": "gnomAD",
      "url": "https://gnomad.broadinstitute.org/",
      "accessed_at": "2026-05-20"
    }
  ],
  "limitations": [
    "DNA does not measure current folate, B12, homocysteine, or other nutrient levels.",
    "This panel does not diagnose a deficiency or recommend a diet, dose, or supplement.",
    "Genetic tendencies describe inherited likelihood, not current diet or symptoms."
  ],
  "clinical_boundary": "Use as inherited context for education and clinician review. Do not present as diagnosis, treatment, or dosing guidance.",
  "model_name": "deterministic-genetic-insight-panel-v1",
  "created_at": "2026-05-21T10:24:13.000Z"
}

{
  "answer_id": "ans_4az91r",
  "genome_id": "gen_test_nutrition_001",
  "question": "What does my DNA say about how I process caffeine?",
  "response_length": "medium",
  "answer": "For caffeine, the relevant finding is CYP1A2 rs762551, where you have one copy of A and one copy of C. That genotype is associated with CYP1A2 inducibility and caffeine-metabolism rate — the *1F allele is linked to higher inducible activity in some studies, leaning toward a faster-metabolizer pattern — but smoking and other inducers also strongly affect CYP1A2, so genotype is only part of the picture. Treat this as inherited context established mainly in broad populations, not a measurement of how you process caffeine today, and not medical advice. (Evidence: GWAS Catalog, PharmGKB.)",
  "structured_findings": [
    {
      "id": "rs762551",
      "title": "CYP1A2 rs762551",
      "domain": "general",
      "evidence_level": "moderate",
      "summary": "Has one copy of A and one copy of C. Associated with CYP1A2 inducibility and caffeine-metabolism rate; the *1F allele links to higher inducible activity in some studies. Smoking and other inducers also strongly affect CYP1A2, so genotype is only part of the picture.",
      "result": { "genotype": "AC", "alleles": ["A", "C"] },
      "result_label": "One copy of A and one copy of C",
      "meaning": "Associated with CYP1A2 inducibility and caffeine-metabolism rate; the *1F allele links to higher inducible activity in some studies. Smoking and other inducers also strongly affect CYP1A2, so genotype is only part of the picture.",
      "validated_populations": ["broad"]
    }
  ],
  "citations": [
    { "source": "gwas_catalog", "version": "2026.05-sandbox" },
    { "source": "pharmgkb", "version": "2026.05-sandbox" }
  ],
  "interpretation_version": "2026.05.1",
  "safety": {
    "clinical_advice": false,
    "requires_clinician_review": true
  },
  "cost_cents": 5,
  "currency": "usd",
  "created_at": "2026-05-21T10:25:41.000Z"
}

{
  "context_id": "ctx_7v1a9k",
  "genome_id": "gen_test_nutrition_001",
  "domain": "nutrition_diet_response",
  "detail_level": "standard",
  "summary": "Genome gen_test_nutrition_001 context for nutrition_diet_response. Bounded structured findings are included, each with the user's result and what it means. This is biological context for software use, not clinical diagnosis.",
  "structured_findings": [
    {
      "id": "rs4988235",
      "title": "MCM6 rs4988235",
      "domain": "nutrition_diet_response",
      "evidence_level": "high",
      "summary": "Has one copy of G and one copy of A. The main lactase-persistence variant in European-ancestry populations; the persistence allele is associated with digesting dairy into adulthood.",
      "result": { "genotype": "GA", "alleles": ["G", "A"] },
      "result_label": "One copy of G and one copy of A",
      "meaning": "The main lactase-persistence variant in European-ancestry populations; the persistence allele is associated with digesting dairy into adulthood. Other persistence variants in African and Middle Eastern populations are not captured by this SNP.",
      "validated_populations": ["European"]
    }
  ],
  "citations": [
    { "source": "gwas_catalog", "version": "2026.05-sandbox" }
  ],
  "interpretation_version": "2026.05.1",
  "cost_cents": 5,
  "currency": "usd"
}